Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291925

Xenopus ORFeome

ORF Name:qrich1.1 ORF1 Species: laevis
Gene Symbol: qrich1.1.L Entrez Gene ID: 414463
Gene Synonyms:
Gene Name: glutamine-rich 1, gene 1
Description: zinc finger
Plate: GDExl11027 Well: H05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ825501
3' ORF Sequence: JZ825500
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC81284, mRNA (cDNA clone MGC:81284 IMAGE:6631880), complete cds
Template Accession: BC068767
GI: 46250323
Clone ID: MGC:81284 IMAGE:6631880
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATAATTCTTTGGAGAACACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCATGTTGCTGGCACT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556