Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291949

Xenopus ORFeome

ORF Name:qsox2 ORF1 Species: laevis
Gene Symbol: qsox2.S Entrez Gene ID: 447270
Gene Synonyms: qscn6l1, soxn
Gene Name: quiescin sulfhydryl oxidase 2
Description: FAD-dependent sulfhydryl oxidase/quiescin and related proteins
Plate: GDExl11051 Well: G07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ831699
3' ORF Sequence: JZ831700
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC86371 protein, mRNA (cDNA clone MGC:86371 IMAGE:7010922), complete cds
Template Accession: BC079798
GI: 50927233
Clone ID: MGC:86371 IMAGE:7010922
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGCGTTCGTCGGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAAAAGGTCGGTTGTATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556