Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291967

Xenopus ORFeome
What is the ORFeome?

ORF Name:r3hdm1.L ORF1 Species: laevis
Gene Symbol: r3hdm1.L Entrez Gene ID: 100381111
Gene Synonyms: r3hdm
Gene Name: R3H domain containing 1
Description: mRNA-binding protein Encore
Plate: GDExl11028 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825638
3' ORF Sequence: JZ825637
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:83834 IMAGE:6643109, complete cds
Template Accession: BC070789
GI: 47124797
Clone ID: IMAGE:6643109
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGATGTCTGGTACTGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGATTGAGTGACAGGAGGGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556