Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291979

Xenopus ORFeome

ORF Name:rab10 ORF1 Species: laevis
Gene Symbol: rab10.L Entrez Gene ID: 398835
Gene Synonyms:
Gene Name: RAB10, member RAS oncogene family
Description: GTP-binding protein
Plate: GDExl11018 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ824444
3' ORF Sequence: JZ829799
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68629, mRNA (cDNA clone MGC:68629 IMAGE:4032253), complete cds
Template Accession: BC060015
GI: 37747685
Clone ID: MGC:68629 IMAGE:4032253
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAAAAAGACGTACGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAACATTTGCTCTTCCAGCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556