Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17291985

Xenopus ORFeome

ORF Name:rab11a ORF1 Species: laevis
Gene Symbol: rab11a.S Entrez Gene ID: 447589
Gene Synonyms: ab11a, rab11
Gene Name: RAB11A, member RAS oncogene family
Description: small GTPase
Plate: GDExl11060 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833109
3' ORF Sequence: JZ833110
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84419 protein, mRNA (cDNA clone MGC:84419 IMAGE:7019309), complete cds
Template Accession: BC081187
GI: 51895839
Clone ID: MGC:84419 IMAGE:7019309
Tissue: brain
Stage: frog
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGTACCAGGGACGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGATGTTCTGACAGCATTGCATCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556