Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17292009

Xenopus ORFeome

ORF Name:rab11fip4l ORF1 Species: laevis
Gene Symbol: rab11fip4l.L Entrez Gene ID: 735126
Gene Synonyms:
Gene Name: RAB11 family interacting protein 4 (class II) like
Description: Centrosomal protein Nuf
Plate: GDExl11081 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836988
3' ORF Sequence: JZ836987
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115550, mRNA (cDNA clone MGC:115550 IMAGE:3378168), complete cds
Template Accession: BC097825
GI: 66911586
Clone ID: MGC:115550 IMAGE:3378168
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGACCCATAGAAACACAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCTCTTCGGCAATGGTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556