Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17292021

Xenopus ORFeome

ORF Name:rab13 ORF1 Species: laevis
Gene Symbol: rab13.L Entrez Gene ID: 100158399
Gene Synonyms: gig4
Gene Name: RAB13, member RAS oncogene family
Description:
Plate: GDExl11083 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837370
3' ORF Sequence: JZ837369
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100158399, mRNA (cDNA clone MGC:154835 IMAGE:8329546), complete cds
Template Accession: BC124978
GI: 115528809
Clone ID: MGC:154835 IMAGE:8329546
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAAAGCCTACGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGCACCGAACACTTGTTACTTCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556