Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17292177

Xenopus ORFeome
What is the ORFeome?

ORF Name:rab3d.L ORF1 Species: laevis
Gene Symbol: rab3d.L Entrez Gene ID: 399230
Gene Synonyms: rab16, rab3d-a, rab3d-b, rad3d
Gene Name: RAB3D, member RAS oncogene family
Description: small GTPase
Plate: GDExl11087 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837955
3' ORF Sequence: JZ837954
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis similar to RAB3D, member RAS oncogene family, mRNA (cDNA clone MGC:130815 IMAGE:7983660), complete cds
Template Accession: BC106308
GI: 76779771
Clone ID: IMAGE:7983660
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCTGCCAGCGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACAGGAGCAGTTGCTGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556