Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17292363

Xenopus ORFeome
What is the ORFeome?

ORF Name:racgap1.L ORF1 Species: laevis
Gene Symbol: racgap1.L Entrez Gene ID: 431862
Gene Synonyms: cyk-4, id-gap, mgcracgap
Gene Name: Rac GTPase activating protein 1
Description: GTPase-activating protein
Plate: GDExl11028 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825548
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC83804, mRNA (cDNA clone MGC:83804 IMAGE:6642263), complete cds
Template Accession: BC070771
GI: 47124784
Clone ID: IMAGE:6642263
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGACAAACCTGATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTTAGCAGAGGTGAGGCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556