Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17292675

Xenopus ORFeome
What is the ORFeome?

ORF Name:rax.L ORF1 Species: laevis
Gene Symbol: rax.L Entrez Gene ID: 397999
Gene Synonyms: rax-a, rax-b, rax1, rx, rx-1, rx1, rx1a, rx2a, xrax, xrx1, xrx1a
Gene Name: retina and anterior neural fold homeobox
Description: homeodomain transcription factor
Plate: GDExl11087 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838112
3' ORF Sequence: JZ838111
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis retinal homeobox 2A, mRNA (cDNA clone MGC:154350 IMAGE:7981696), complete cds
Template Accession: BC123153
GI: 114107823
Clone ID: IMAGE:7981696
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCACCTGCACAGTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATATGGTTTGCCAAGGCTTGCCGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556