Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293011

Xenopus ORFeome
What is the ORFeome?

ORF Name:rcvrn.2.L ORF1 Species: laevis
Gene Symbol: rcvrn.2.L Entrez Gene ID: 447358
Gene Synonyms: rcv1, rcvrn.2-a, rcvrn.2-b, recoverin
Gene Name: recoverin, gene 2
Description: neuronal calcium sensor similar to recoverin
Plate: GDExl11058 Well: B04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ832731
3' ORF Sequence: JZ832732
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84117 protein, mRNA (cDNA clone MGC:84117 IMAGE:6950227), complete cds
Template Accession: BC080075
GI: 51261480
Clone ID: IMAGE:6950227
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAACGCCAAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCGGGTCGTACTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers