Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293017

Xenopus ORFeome
What is the ORFeome?

ORF Name:rcvrn.2.S ORF1 Species: laevis
Gene Symbol: rcvrn.2.S Entrez Gene ID: 444827
Gene Synonyms: rcv1, rcvrn.2-a, rcvrn.2-b, recoverin
Gene Name: recoverin, gene 2
Description: neuronal calcium sensor similar to recoverin
Plate: GDExl11059 Well: A12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833035
3' ORF Sequence: JZ833036
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84424 protein, mRNA (cDNA clone MGC:84424 IMAGE:7019444), complete cds
Template Accession: BC075232
GI: 49522176
Clone ID: IMAGE:7019444
Tissue: brain
Stage:
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGGAACGCCAAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCTTCGGGGTGTATTGAATAAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers