Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293251

Xenopus ORFeome
What is the ORFeome?

ORF Name:rgs1.S ORF1 Species: laevis
Gene Symbol: rgs1.S Entrez Gene ID: 447113
Gene Synonyms: 1r20, bl34, ier1, ir20
Gene Name: regulator of G-protein signaling 1
Description: G protein signaling regulators
Plate: GDExl11003 Well: G11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839718
3' ORF Sequence: JZ839717
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC85328 protein, mRNA (cDNA clone MGC:85328 IMAGE:6875998), complete cds
Template Accession: BC078517
GI: 51593173
Clone ID: IMAGE:6875998
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGGAAAAACTCCTTG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCCTCTCACATTATTTCCATGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.1


Major funding for Xenbase is provided by grant P41 HD064556