Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293341

Xenopus ORFeome
What is the ORFeome?

ORF Name:rhbg.L ORF1 Species: laevis
Gene Symbol: rhbg.L Entrez Gene ID: 398784
Gene Synonyms: rhbg-a, rhbg-b, slc42a2
Gene Name: Rh family B glycoprotein (gene/pseudogene)
Description: ammonium transporter
Plate: GDExl11018 Well: E06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824480
3' ORF Sequence: JZ829834
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Ammonium transporter Rh type B-A, mRNA (cDNA clone MGC:68642 IMAGE:4032424), complete cds
Template Accession: BC059979
GI: 37748695
Clone ID: IMAGE:4032424
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCGGATTAAGTTGCCCTTAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTGCGTATCCGGGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556