Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293347

Xenopus ORFeome
What is the ORFeome?

ORF Name:rhbg.S ORF1 Species: laevis
Gene Symbol: rhbg.S Entrez Gene ID: 447041
Gene Synonyms: rhbg-a, rhbg-b, slc42a2
Gene Name: Rh family B glycoprotein (gene/pseudogene)
Description: ammonium transporter
Plate: GDExl11041 Well: F10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828034
3' ORF Sequence: JZ828035
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Rhesus blood group, B glycoprotein, mRNA (cDNA clone MGC:82988 IMAGE:5516045), complete cds
Template Accession: BC078079
GI: 50415407
Clone ID: IMAGE:5516045
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACCAGCTACTCCACCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACGCTTGAGTATCTGGGTCCTCGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556