Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293371

Xenopus ORFeome
What is the ORFeome?

ORF Name:rho.L ORF1 Species: laevis
Gene Symbol: rho.L Entrez Gene ID: 380209
Gene Synonyms: opn2, rh1, rhodopsin, rp4, xrho
Gene Name: rhodopsin
Description: G protein-coupled receptor
Plate: GDExl11003 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839467
3' ORF Sequence: JZ839466
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis rhodopsin, mRNA (cDNA clone MGC:64248 IMAGE:6881143), complete cds
Template Accession: BC054145
GI: 32450562
Clone ID: IMAGE:6881143
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAACGGAACAGAGGGTCCCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGCAGGAGACACCTGGCTGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556