Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293557

Xenopus ORFeome
What is the ORFeome?

ORF Name:rlim.S ORF1 Species: laevis
Gene Symbol: rlim.S Entrez Gene ID: 398680
Gene Synonyms: rlim-a, rlim-b, rnf12, rnf12b, xrnf12
Gene Name: ring finger protein, LIM domain interacting
Description: mediator of ubiquitin ligase activity
Plate: GDExl11032 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826306
3' ORF Sequence: JZ826307
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis XRnf12 protein, mRNA (cDNA clone MGC:78888 IMAGE:4174178), complete cds
Template Accession: BC082339
GI: 51950094
Clone ID: IMAGE:4174178
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGAGTGCTGATTCCACG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAATGCTCTCTCTGTTGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers