Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293659

Xenopus ORFeome
What is the ORFeome?

ORF Name:rnf11.L ORF2 Species: laevis
Gene Symbol: rnf11.L Entrez Gene ID: 380123
Gene Synonyms: mgc89047
Gene Name: ring finger protein 11
Description: mediator of ubiquitin ligase activity
Plate: GDExl11064 Well: C02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833723
3' ORF Sequence: JZ833724
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ring finger protein 11, mRNA (cDNA clone MGC:130820 IMAGE:7207751), complete cds
Template Accession: BC108492
GI: 80476312
Clone ID: IMAGE:7207751
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGCAATTGCCTTAAGTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTCGTCTCATAGGATGAGAGCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers