Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17293719

Xenopus ORFeome
What is the ORFeome?

ORF Name:rnf13.L ORF1 Species: laevis
Gene Symbol: rnf13.L Entrez Gene ID: 399073
Gene Synonyms:
Gene Name: ring finger protein 13
Description: mediator of ubiquitin ligase activity
Plate: GDExl11022 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824816
3' ORF Sequence: JZ830187
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68556, mRNA (cDNA clone MGC:68556 IMAGE:4031366), complete cds
Template Accession: BC063734
GI: 39645070
Clone ID: IMAGE:4031366
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTAACGTTCAAGATGTGCTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACTGTATTCCTTTCCCTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers