Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17294025

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpe.S ORF1 Species: laevis
Gene Symbol: rpe.S Entrez Gene ID: 494647
Gene Synonyms: rpe2-1
Gene Name: ribulose-5-phosphate-3-epimerase
Description: D-ribulose-5-phosphate 3-epimerase
Plate: GDExl11059 Well: D07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833069
3' ORF Sequence: JZ833070
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC494647, mRNA (cDNA clone MGC:84434 IMAGE:7019576), complete cds
Template Accession: BC082474
GI: 52078453
Clone ID: IMAGE:7019576
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCGTCTGGGTGCAAGATCGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCGATCTAATGAGCGTTTTTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556