Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17294685

Xenopus ORFeome
What is the ORFeome?

ORF Name:rps6ka1.L ORF1 Species: laevis
Gene Symbol: rps6ka1.L Entrez Gene ID: 445821
Gene Synonyms: hu-1, mapkapk1a, p90-rsk, rsk, rsk1
Gene Name: ribosomal protein S6 kinase A1
Description: serine/threonine kinase
Plate: GDExl11044 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828349
3' ORF Sequence: JZ828348
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis S6 kinase II beta, mRNA (cDNA clone MGC:81220 IMAGE:6318872), complete cds
Template Accession: BC071102
GI: 49256531
Clone ID: IMAGE:6318872
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCTGGCACAACTGGTGGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAAGAGTAATAGAAGGTAGCTTCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556