Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17294745

Xenopus ORFeome
What is the ORFeome?

ORF Name:rpsa.S ORF1 Species: laevis
Gene Symbol: rpsa.S Entrez Gene ID: 380422
Gene Synonyms: 37-kd lr, 37lrp, 67-kd lr, lambr, laminin receptor, lamr1, lr, lrp, p40
Gene Name: ribosomal protein SA
Description: 40S ribosomal protein SA (P40)/Laminin receptor 1
Plate: GDExl11017 Well: A04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824386
3' ORF Sequence: JZ829745
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis laminin receptor 1 (ribosomal protein SA, 67 kDA), mRNA (cDNA clone MGC:53465 IMAGE:5572059), complete cds
Template Accession: BC046271
GI: 28277315
Clone ID: IMAGE:5572059
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGGAGGTCTTGATGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCATTCAGTAGTAGTTCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556