Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295027

Xenopus ORFeome

ORF Name:s100a10 ORF1 Species: laevis
Gene Symbol: s100a10.L Entrez Gene ID: 378505
Gene Synonyms: 42c, anx2l, anx2lg, cal1l, calpactin, clp11, gp11, p11, s100a10-a, s100a10-b
Gene Name: S100 calcium binding protein A10
Description:
Plate: GDExl11003 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ839677
3' ORF Sequence: JZ839676
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis S100 calcium binding protein A10 (calpactin) a, mRNA (cDNA clone MGC:85301 IMAGE:6874918), complete cds
Template Accession: BC078507
GI: 51593167
Clone ID: MGC:85301 IMAGE:6874918
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGCCCCCTCTGAGCTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGACTTTCATGTGTTTGACGTAATA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556