Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295033

Xenopus ORFeome

ORF Name:s100a11 ORF1 Species: laevis
Gene Symbol: s100a11.L Entrez Gene ID: 443554
Gene Synonyms: dicalcin, mln70, p26olf, s100c
Gene Name: S100 calcium binding protein A11
Description:
Plate: GDExl11093 Well: D03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838918
3' ORF Sequence: JZ838917
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis calcium-binding protein p26olf, mRNA (cDNA clone MGC:160451 IMAGE:8641836), complete cds
Template Accession: BC128955
GI: 123959687
Clone ID: MGC:160451 IMAGE:8641836
Tissue: skin
Stage: unspecified stage
Clone Library: NICHD_XGC_skin_m
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCCAGATGCGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGGTTTCTTGGGGTGAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556