Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295039

Xenopus ORFeome

ORF Name:s100pbp ORF1 Species: laevis
Gene Symbol: s100pbp.L Entrez Gene ID: 735242
Gene Synonyms:
Gene Name: S100P binding protein
Description: Nucleolar GTPase/ATPase p130
Plate: GDExl11082 Well: C10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837188
3' ORF Sequence: JZ837187
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis S100P-binding protein, mRNA (cDNA clone MGC:132224 IMAGE:5155235), complete cds
Template Accession: BC110957
GI: 83405216
Clone ID: MGC:132224 IMAGE:5155235
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGAGATAAGAATCAGCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTAGGTCCTGTGGGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556