Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295057

Xenopus ORFeome

ORF Name:sac3d1 ORF1 Species: laevis
Gene Symbol: sac3d1.L Entrez Gene ID: 444188
Gene Synonyms:
Gene Name: SAC3 domain containing 1
Description: Nuclear protein export factor
Plate: GDExl11041 Well: C06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ827754
3' ORF Sequence: JZ827755
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: bad
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80708 protein, mRNA (cDNA clone MGC:80708 IMAGE:5511721), complete cds
Template Accession: BC073309
GI: 49119273
Clone ID: MGC:80708 IMAGE:5511721
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGGCAGAGGGCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAAGCGTTTTCTCCCATCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556