Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295063

Xenopus ORFeome

ORF Name:sae1 ORF1 Species: laevis
Gene Symbol: sae1.L Entrez Gene ID: 443558
Gene Synonyms: aos, aos1p, sua1p
Gene Name: SUMO1 activating enzyme subunit 1
Description: ubiquitin-protein ligase
Plate: GDExl11068 Well: A05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834542
3' ORF Sequence: JZ834543
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis SUMO-1 activating enzyme E1 N subunit, mRNA (cDNA clone MGC:78909 IMAGE:4175466), complete cds
Template Accession: BC086263
GI: 55715631
Clone ID: MGC:78909 IMAGE:4175466
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGAGAAGGAGGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTGGAACCCAGGCAGTCAACTA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556