Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295075

Xenopus ORFeome

ORF Name:sall1 ORF1 Species: laevis
Gene Symbol: sall1.L Entrez Gene ID: 379679
Gene Synonyms: sal-1, sal-like 1, sal1, sall1-a, sall1-b, sall1b, spalt-like 1, tbs, znf794
Gene Name: spalt-like transcription factor 1
Description: zinc finger transcription factor
Plate: GDExl11020 Well: B08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ824667
3' ORF Sequence: JZ830019
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68418, mRNA (cDNA clone MGC:68418 IMAGE:6862463), complete cds
Template Accession: BC059284
GI: 37590272
Clone ID: MGC:68418 IMAGE:6862463
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAATCTGAACCAGAAGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGTTCTTACCTTAAGGTTGCCTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556