Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295081

Xenopus ORFeome
What is the ORFeome?

ORF Name:sall2.L ORF1 Species: laevis
Gene Symbol: sall2.L Entrez Gene ID: 100191025
Gene Synonyms: salf, xsal2, xsalf, xsalf-a, xsalf-b
Gene Name: spalt-like transcription factor 2
Description: zinc finger transcription factor
Plate: GDExl11033 Well: E11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ826530
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:82592 IMAGE:4970942, complete cds
Template Accession: BC073007
GI: 49118057
Clone ID: IMAGE:4970942
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATGGACTGTCTGGACCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTCTCTTCCTTAATTGGACTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556