Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295597

Xenopus ORFeome
What is the ORFeome?

ORF Name:sec14l1.L ORF1 Species: laevis
Gene Symbol: sec14l1.L Entrez Gene ID: 444132
Gene Synonyms:
Gene Name: SEC14-like lipid binding 1
Description: transporter
Plate: GDExl11041 Well: F02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827788
3' ORF Sequence: JZ827789
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80554 protein, mRNA (cDNA clone MGC:80554 IMAGE:5435162), complete cds
Template Accession: BC073228
GI: 49115202
Clone ID: IMAGE:5435162
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTTGTTGGCAGTGACATAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCTGGAAACCATGGAACT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556