Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17295693

Xenopus ORFeome
What is the ORFeome?

ORF Name:sec63.L ORF1 Species: laevis
Gene Symbol: sec63.L Entrez Gene ID: 495416
Gene Synonyms:
Gene Name: SEC63 homolog, protein translocation regulator
Description: molecular chaperone, endoplasmic reticulum translocon component
Plate: GDExl11085 Well: G03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837732
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495416, mRNA (cDNA clone MGC:132056 IMAGE:6857297), complete cds
Template Accession: BC110927
GI: 83405238
Clone ID: IMAGE:6857297
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCGGGCAGCAGTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCATCCTCATCTTCATCATCTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556