Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17296047

Xenopus ORFeome
What is the ORFeome?

ORF Name:kmt5a.S ORF1 Species: laevis
Gene Symbol: kmt5a.S Entrez Gene ID: 100158384
Gene Synonyms: setd8
Gene Name: lysine methyltransferase 5A
Description: Predicted methyltransferase (contains a SET domain)
Plate: GDExl11083 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837338
3' ORF Sequence: JZ837337
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Histone-lysine N-methyltransferase SETD8-A, mRNA (cDNA clone MGC:154751 IMAGE:6317540), complete cds
Template Accession: BC124952
GI: 115528302
Clone ID: IMAGE:6317540
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAAGAGGGAAGAAAATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTTTTAAGCCAAGGATGTGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556