Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17296137

Xenopus ORFeome
What is the ORFeome?

ORF Name:sftpb.L ORF1 Species: laevis
Gene Symbol: sftpb.L Entrez Gene ID: 779297
Gene Synonyms: sp-b, xsp-b
Gene Name: surfactant, pulmonary-associated protein B
Description: enhances rate of spreading and stability of surfactant monolayers in the lung [Entrez]
Plate: GDExl11082 Well: G10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837283
3' ORF Sequence: JZ837282
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC154673, mRNA (cDNA clone MGC:154673 IMAGE:4056954), complete cds
Template Accession: BC123315
GI: 114108320
Clone ID: IMAGE:4056954
Tissue: lung
Stage:
Clone Library: NICHD_XGC_Lu1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAAGGGACACGCCTGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGCCACACATGGGTCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556