Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17296647

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc17a5.S ORF1 Species: laevis
Gene Symbol: slc17a5.S Entrez Gene ID: 100158341
Gene Synonyms:
Gene Name: solute carrier family 17 member 5
Description: transmembrane solute exchange
Plate: GDExl11088 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ838086
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100158341, mRNA (cDNA clone MGC:154372 IMAGE:8071221), complete cds
Template Accession: BC124865
GI: 115528238
Clone ID: IMAGE:8071221
Tissue: fat body
Stage:
Clone Library: NICHD_XGC_FaB
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGGAGACGGGAGAGCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTCCTCTTCTATATTGTGGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers