Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297421

Xenopus ORFeome
What is the ORFeome?

ORF Name:slc8a3.S ORF1 Species: laevis
Gene Symbol: slc8a3.S Entrez Gene ID: 446366
Gene Synonyms: ncx3
Gene Name: solute carrier family 8 (sodium/calcium exchanger), member 3
Description: Ca2+/Na+ exchanger NCX1 and related proteins
Plate: GDExl11044 Well: G05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830596
3' ORF Sequence: JZ830597
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis solute carrier family 8 (sodium-calcium exchanger), member 2, mRNA (cDNA clone MGC:83127 IMAGE:6318259), complete cds
Template Accession: BC076761
GI: 49903376
Clone ID: IMAGE:6318259
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTCAACTAAAGTTGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACACAGTTTCATCATTCTTGAATTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers