Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297469

Xenopus ORFeome
What is the ORFeome?

ORF Name:smad1.L ORF1 Species: laevis
Gene Symbol: smad1.L Entrez Gene ID: 379664
Gene Synonyms: mlp, smad-1, smad1-a, smad1-b, xmad, xmad1, xsmad1
Gene Name: SMAD family member 1
Description: signal transduction, TGF-beta pathway
Plate: GDExl11021 Well: E05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824731
3' ORF Sequence: JZ830083
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis mothers against DPP, mRNA (cDNA clone MGC:69097 IMAGE:5047316), complete cds
Template Accession: BC057746
GI: 34784621
Clone ID: IMAGE:5047316
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATGTGACAAGCCTTTTCTCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGACAGAGGAGATGGGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556