Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297487

Xenopus ORFeome
What is the ORFeome?

ORF Name:smad4.2.S ORF1 Species: laevis
Gene Symbol: smad4.2.L Entrez Gene ID: 403356
Gene Synonyms: dpc4, jip, madh4, smad10, smad4.2-a, smad4.2-b, smad4b, smad4beta, xsmad4, xsmad4b, xsmad4beta
Gene Name: SMAD family member 4, gene 2
Description: TGFbeta receptor signaling protein SMAD and related proteins
Plate: GDExl11030 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825880
3' ORF Sequence: JZ825879
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC079969.1 Xenopus laevis Xsmad4b protein, mRNA (cDNA clone MGC:79909 IMAGE:4031315), complete cds
Template Accession: BC079969
GI: 51258223
Clone ID: IMAGE:4031315
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCTCTGACCCCTCCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGACAGAACTGGGGTCTGCCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers