Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297493

Xenopus ORFeome
What is the ORFeome?

ORF Name:smad6.L ORF1 Species: laevis
Gene Symbol: smad6.L Entrez Gene ID: 399369
Gene Synonyms: madh6, xsmad6
Gene Name: SMAD family member 6
Description: signal transduction, TGF-beta pathway
Plate: GDExl11025 Well: A06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825135
3' ORF Sequence: JZ830496
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Smad6 protein, mRNA (cDNA clone MGC:79921 IMAGE:6317366), complete cds
Template Accession: BC068642
GI: 46250055
Clone ID: IMAGE:6317366
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTCAGGTCCAGACGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTTCCCAGTAGGACCTCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556