Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297535

Xenopus ORFeome
What is the ORFeome?

ORF Name:smarcal1.L ORF1 Species: laevis
Gene Symbol: smarcal1.L Entrez Gene ID: 734728
Gene Synonyms: harp
Gene Name: SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a-like 1
Description: chromatin remodeling protein
Plate: GDExl11082 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ837074
3' ORF Sequence: JZ837073
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis SWI/SNF-related matrix-associated actin-dependent regulator of chromatin subfamily A-like protein 1, mRNA (cDNA clone MGC:115661 IMAGE:6323401), complete cds
Template Accession: BC100245
GI: 71681278
Clone ID: IMAGE:6323401
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCGTCTGTCTGACGGAGGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGTGCAAAGTAATCGTCAATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556