Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297745

Xenopus ORFeome
What is the ORFeome?

ORF Name:snai1.S ORF1 Species: laevis
Gene Symbol: snai1.L Entrez Gene ID: 379615
Gene Synonyms: sna, snail, snail1, xsna, xsnail
Gene Name: snail family zinc finger 1
Description: zinc finger transcriptional repressor
Plate: GDExl11002 Well: F11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839287
3' ORF Sequence: JZ839286
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: BC056857.1 Xenopus laevis snail, mRNA (cDNA clone MGC:64552 IMAGE:6879625), complete cds
Template Accession: BC056857
GI: 34785118
Clone ID: IMAGE:6879625
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCCCGGTCATTTCTGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGGGCCACCGTGCACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556