Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297751

Xenopus ORFeome
What is the ORFeome?

ORF Name:snai2.L ORF1 Species: laevis
Gene Symbol: snai2.L Entrez Gene ID: 379440
Gene Synonyms: slug, snai2-a, snai2-b, snail2, xslu, xslug, xsnail2
Gene Name: snail family zinc finger 2
Description: zinc finger transcriptional repressor
Plate: GDExl11001 Well: C05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839136
3' ORF Sequence: JZ839135
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis snail homolog 2 (Drosophila), mRNA (cDNA clone MGC:64246 IMAGE:6874250), complete cds
Template Accession: BC054144
GI: 32450024
Clone ID: IMAGE:6874250
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACGATCTTTTCTGGTCAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTACACAGCAACCAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556