Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297757

Xenopus ORFeome
What is the ORFeome?

ORF Name:snai2.S ORF1 Species: laevis
Gene Symbol: snai2.S Entrez Gene ID: 398235
Gene Synonyms: slug, snai2-a, snai2-b, snail2, xslu, xslug, xsnail2
Gene Name: snail family zinc finger 2
Description: zinc finger transcriptional repressor
Plate: GDExl11030 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826150
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis zinc finger transcription factor slug beta, mRNA (cDNA clone MGC:78993 IMAGE:4406576), complete cds
Template Accession: BC072087
GI: 47939693
Clone ID: IMAGE:4406576
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACGCTCTTTTCTGGTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGTGCTACACAGCAACCAGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556