Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17297769

Xenopus ORFeome
What is the ORFeome?

ORF Name:snap29.L ORF1 Species: laevis
Gene Symbol: snap29.L Entrez Gene ID: 379768
Gene Synonyms:
Gene Name: synaptosome associated protein 29kDa
Description: SNAP-25 (synaptosome-associated protein) component of SNARE complex
Plate: GDExl11007 Well: A11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ823585
3' ORF Sequence: JZ828883
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis synaptosomal-associated protein, 29kDa, mRNA (cDNA clone MGC:52674 IMAGE:4682503), complete cds
Template Accession: BC041208
GI: 27371250
Clone ID: IMAGE:4682503
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCAGAAGCTACAATCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAGCTCTTCACGGATCCGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556