Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17298021

Xenopus ORFeome
What is the ORFeome?

ORF Name:snw1.S ORF1 Species: laevis
Gene Symbol: snw1.S Entrez Gene ID: 734970
Gene Synonyms: bx42, ncoa-62, prp45, prpf45, skiip, skip
Gene Name: SNW domain containing 1
Description: mRNsplicing factor/probable chromatin binding snw family nuclear protein
Plate: GDExl11078 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836419
3' ORF Sequence: JZ836420
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC132028, mRNA (cDNA clone MGC:132028 IMAGE:5083691), complete cds
Template Accession: BC108751
GI: 83318285
Clone ID: IMAGE:5083691
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGCTAGCCAGTTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTTCCTGCGCTTCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556