Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17298207

Xenopus ORFeome
What is the ORFeome?

ORF Name:sox11.S ORF1 Species: laevis
Gene Symbol: sox11.S Entrez Gene ID: 399440
Gene Synonyms: sox11-a, sox11-b, xls13, xls13a, xls13b, xsox-11, xsox11
Gene Name: SRY-box 11
Description: HMG-box transcription factor
Plate: GDExl11028 Well: A02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825669
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis XLS13B protein, mRNA (cDNA clone MGC:83451 IMAGE:6642770), complete cds
Template Accession: BC070707
GI: 47124741
Clone ID: IMAGE:6642770
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAGCGAGCAGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTAAGTGAAGACCAAGTCTGAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers