Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17298219

Xenopus ORFeome
What is the ORFeome?

ORF Name:sox17a.S ORF1 Species: laevis
Gene Symbol: sox17a.S Entrez Gene ID: 398765
Gene Synonyms: sox17 alpha, sox17-alpha, sox17alpha, tsox17alpha, xsox17, xsox17-alpha, xsox17a, xsox17alpha, xsox17alpha1, xsox17alpha2
Gene Name: SRY-box 17 alpha
Description: HMG-box transcription factor
Plate: GDExl11023 Well: A05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824925
3' ORF Sequence: JZ830293
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC68799, mRNA (cDNA clone MGC:68799 IMAGE:4203277), complete cds
Template Accession: BC060350
GI: 37805208
Clone ID: IMAGE:4203277
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGCCCTGATGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCACTGGGGTAGTTGCAGTA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556