Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17298513

Xenopus ORFeome
What is the ORFeome?

ORF Name:spry2.S ORF1 Species: laevis
Gene Symbol: spry2.S Entrez Gene ID: 398313
Gene Synonyms: sprouty 2, sprouty-2, sprouty2, xsprouty2, xspry2, xtsprouty2
Gene Name: sprouty RTK signaling antagonist 2
Description: regulation of signal transduction
Plate: GDExl11089 Well: E02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838241
3' ORF Sequence: JZ838240
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis sprouty 2, mRNA (cDNA clone MGC:154503 IMAGE:8319302), complete cds
Template Accession: BC124885
GI: 115528252
Clone ID: IMAGE:8319302
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGACGAGAGTACAAAATGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATGTTGGTTTTTCTAAGTTCCTGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers