Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17299101

Xenopus ORFeome
What is the ORFeome?

ORF Name:stk24.L ORF1 Species: laevis
Gene Symbol: stk24.L Entrez Gene ID: 444155
Gene Synonyms: mst3, mst3b, ste20, stk3
Gene Name: serine/threonine kinase 24
Description: Serine/threonine protein kinase
Plate: GDExl11040 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827764
3' ORF Sequence: JZ827765
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC80614 protein, mRNA (cDNA clone MGC:80614 IMAGE:5506115), complete cds
Template Accession: BC073258
GI: 49116765
Clone ID: IMAGE:5506115
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCACTCCCCGGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTGTGAGGAAGAGTCCACCCCAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers