Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17299791

Xenopus ORFeome

ORF Name:tac1 ORF1 Species: laevis
Gene Symbol: tac1.L Entrez Gene ID: 735077
Gene Synonyms: neurokinin 1, neurokinin 2, neurokinin a, neuromedin l, neuropeptide k, nk2, nkna, npk, substance k, substance p, tac2, tachykinin
Gene Name: tachykinin precursor 1
Description:
Plate: GDExl11076 Well: H11
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836276
3' ORF Sequence: JZ836277
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115037, mRNA (cDNA clone MGC:115037 IMAGE:6948590), complete cds
Template Accession: BC092325
GI: 62185721
Clone ID: MGC:115037 IMAGE:6948590
Tissue: eye
Stage: frog
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAAAATCCTCGTAGCTTTTGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAATAATTCAGTAGTGAGTTTCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556