Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17299821

Xenopus ORFeome

ORF Name:tada3 ORF1 Species: laevis
Gene Symbol: tada3.L Entrez Gene ID: 379602
Gene Synonyms: ada3, ngg1, tada3-a, tada3-b, tada3l
Gene Name: transcriptional adaptor 3
Description: Histone acetyltransferases PCAF/SAGA/ADA, subunit TADA3L/NGG1
Plate: GDExl11002 Well: G06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ839301
3' ORF Sequence: JZ839300
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Transcriptional adapter 3-like A, mRNA (cDNA clone MGC:64374 IMAGE:6878201), complete cds
Template Accession: BC056843
GI: 34783926
Clone ID: MGC:64374 IMAGE:6878201
Tissue: whole organism
Stage: NF stage 53
Clone Library: NICHD_XGC_Tad1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCGAGTTAAAGGATTGTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACCATCAAGCAGCTTTAAGATGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556